1 - علت بیماری آلکاپتونوریا چیست و علامت این بیماری کدام است؟

2 - در آزمایش بیدل و تیتوم، هاگ های جهش یافته، چند گروه بودند و هر کدام برای رشد در محیط حداقل به چه ترکیباتی نیازمند بودند؟

3 - کپک نوروسپورا، چه نوع چرخه زندگی دارد؟

4 - در آزمایشات بیدل و تیتوم، به محیط کشت جهش یافته های گروه دوم، چه موادی باید افزود تا هاگها رشد کنند؟

5 - بیدل و تیتوم از آزمایشات خود چه نتایجی گرفتند؟

6 - نظریه یک ژن – یک آنزیم بر اساس چه یافته هایی به نظریه یک ژن- یک رشته پلی پپتید تبدیل گردید؟

7 - در رابطه ی :                         آنزیم3           آنزیم2                  آنزیم1

( آرژینین              سیترولین              اُرنیتین                          X ماده)

اگر آنزیم1 غیر فعال شود، کدام ماده لازم است به محیط کشت اضافه شوند تا رشد هاگ کپک نوروسپورا انجام گیرد؟

8 - در مسیر متابولیسمی، برای تولید اسید آمینه آرژینین در کپک نوروسپورا، چند مولکول mRNA و چند آنزیم تولید می شود؟

9 - الف- از اطلاعات ژنتیک برای ساختن چه ترکیباتی استفاده می شود؟

ب- چرا رمزهای DNA باید3 حرفی با شند؟

ج- در هر نوکلئوتید کدام ترکیب، علامت رمز محسوب می شود؟

10 - بر اساس چه اطلاعات و شواهدی، دانشمندان یقین حاصل کردند که مولکول میانجی در پروتئین سازی باید مولکول RNA باشد؟

11 - در سلول، چند نوع  RNA یافت می شود و نقش هر کدام چیست؟ 

12 - اولین قدم جهت ساخت پروتئین، چه فرایندی است؟

13 - در سلول های پروکاریوتی چند نوع RNA پلیمراز وجود دارد؟

14 - در سلولهای یوکاریوتی چند نوع RNA پلیمراز وجود دارد و نقش هر کدام چیست؟

15 - رونویسی از ژن های RNA های کوچک را کدام آنزیمها در یوکاریوتها انجام می دهند؟

16 - راه انداز در چه مولکولی وجود دارد و نقش آن چیست؟

17 - الف- مونومرهای جایگاه پایان رونویسی چه نام دارد؟

ب- در هنگام رونویسی از DNA چه مولکولی دو رشته DNA  را از هم جدا می کند؟

18 - فرایندهای همانند سازی DNA و رونویسی DNA چه شباهتها و تفاوت هایی با یکدیگر دارند؟

19 - چگونه می توان پیام t RNA را معلوم کرد؟

20 - کدون را تعریف کنید و ویژگی عمومی آنها را بنویسید؟

21 - فرایند ترجمه را تعریف کنید؟

22 - آنتی کدون را تعریف کنید و نقش آن را در سنتز پروتئین بنویسید؟

23 - علت تشکیل ساختار برگ شبدری در t RNA چیست؟

24 - الف- ساختار 3 بعدی t RNA در سلول چه نام دارد؟

ب- در ساختار برگ شبدری t RNA علت تشکیل حلقه ها چیست؟

ج- نقش حلقه های جانبی در t RNA چیست؟

د- با توجه به اینکهt RNA تک رشته ای است، علت بخش های دو رشته ای در ساختار آن چیست؟

25 - در محل اتصال آمینواسید به t RNA چه نوع توالی مشاهده می شود؟

26 - هر ریبوزوم چند جایگاه دارد و در هر جایگاه چه فرایندی روی می دهد؟

27 - الف- اولین فرایند در مرحله ی آغاز ترجمه کدام است؟

ب- در مرحله ی آغاز ترجمه t RNA ی آغازگر به کدام جایگاه وارد می شود و آنتی کدون آن شامل چه نوع توالی است؟

ج- اگر یک رشته پلی پپتیدی درجایگاه A دارای7 اسیدآمینه با شد ریبوزوم چند بار در طول m RNA حرکت کرده است و حداقل چند پیوند هیدروژنی شکسته شده است؟

28 - در مرحله آغاز فرآیند ترجمه چگونه ساختار ریبوزوم برای ترجمه کامل می شود؟

29 - الف- اولین آنتی کدونی که در جایگاه P ریبوزوم قرار می گیرد، چیست؟

ب- اگر رمز DNA ، TTC باشد آنتی کدون مربوط به آن چیست؟

30 - مرحله ی ادامه ی ترجمه چگونه آغاز می شود؟

31 - در کدام جایگاه ریبوزوم  پیوند پپتیدی تشکیل می شود و ضمن جا به جایی ریبوزوم  کدام جایگاه خالی می شود؟

32 - الف- عامل پایان ترجمه به کدام جایگاه وارد می شود؟

ب- عامل پایان ترجمه چه نقشی به عهده دارد و این نقش را در کدام جایگاه به انجام می رساند؟

ج- چگونه فرآیند ترجمه پایان می پذیرد؟

33 - در ارتباط با توالی نوکلئوتید روبه رو :    

             CGCAUCAUGCUCUUUAGCUAGCUG 

الف- آنتی کدون t RNA آغازگر بر روی کدام کدون قرار می گیرد؟

ب- آخرین رمز قرار گیرنده در جایگاه P ریبوزوم کدام است؟

ج- سومین آمینواسید در زنجیره ی پلی پپتید مربوطه چه نام دارد؟

د-  آخرین آمینواسید متصل به آخرین t RNA در کدام کدون قرار می گیرد؟

34 - با توجه به m RNA داده شده جهت ترجمه به سؤالهای زیر پاسخ دهید؟

 AGU UAC AUG ACG CCA UUA UGU UAG GUA

الف- اگر ترجمه توسط ریبوزوم از محل درست آغاز گردد تعداد آمینواسید تشکیل شده در زنجیره ی پلی پپتید را مشخص کنید؟

ب- ریبوزوم حین ترجمه در طول m RNA ی فوق چند بار حرکت می کند؟

ج- جایگاه P و A هر کدام چند بار توسط t RNA اشغال شده است؟

35 - ژن های گسسته در چه سلول هایی وجود دارد ؟ و چرا به این نام خوانده می شود؟

36 - اگزون و اینترون را تعریف کنید؟

37 - الف- مونومرهای توالی اگزون چه نام دارد؟

ب- علت کوتاه شدن m RNA در سلولهای یوکاریوتی چیست؟

ج- علت گسسته بودن ژنها در سلولهای یوکاریوتی کدام است؟

د-m RNA ی بالغ در چه بخشهایی از سلول تشکیل و در چه بخشی از سلول ترجمه می شود؟

38 - یک m RNA که از چهار اگزون و سه اینترون تشکیل شده است، برای حذف اینترونها چند پیوند فسفو دی استر شکسته می شود و برای اتصال اگزونها چند پیوند فسفو دی استر تشکیل می شود؟

 

 

 

 

فصل اول از ژن تا پروتئين

(تنظيم بيان ژن)

1 - اپران چیست ؟ بخشهای تشکیل دهنده آن را بنویسید.

2 - اصطلاحات زیر را تعریف کنید.

الف) عامل تنظیم کننده                ب) اپراتور                ج) افزاینده

3 - تفاوت بخش ساختاری وبخش تنظیم کننده اپران را بنویسید.

4 - چرا تنظیم بیان ژن در یوکاریوتها پیچیده تر است؟

5 - بعد از رونویسی ژن مقابل چند نوع MRNAتولید میشود؟ X  E    X       E            X               E        X                         

MRNAرونویسی شده درهسته و  MRNA  سیتوپلاسمی را رسم کنید.

_____/__/_____________/__/_____/__/_____

Xعلامت اگزون   و E علامت اینترون است.

6 - جهش را تعریف کرده انواع جهش نقطه ای را توضیح دهید؟

7 - چگونه ممکن است جهش نقطه ای تاثیری در بیان ژن نداشته باشد؟ با ذکر مثال شرح دهید.

8 - نحوه خاموش شدن اپران لک را توضیح دهید.

9 - به سوالات زیر پاسخ کوتاه دهید.

الف) عامل تنظیم کننده اپران لک چه نام دارد؟

ب)  در کدامیک از سلولها آنزیم RNAپلیمراز نمیتواند به تنهایی راه انداز را شناسایی کند؟

ج) در اپران لک ژن ساختاری چند ژن و چند راه انداز دارد؟

د)  بعد از روشن شدن اپران لک چند نوع MRNA ساخته میشود؟

10 - در فرایند رونویسی شناسایی راه انداز توسط آنزیم دراِکلای چه تفاوتی با شناسایی راه انداز در گلبولهای سفید دارد؟

11 - تنظیم بیان ژن در سلولهای انسان ممکن است در چه سطوحی صورت بگیرد؟

12 - اگر فقط قند لاکتوز در اختیار اِکلای قرار گیرد :

الف) جه نوع آنزیمهایی در باکتری ساخته میشود؟

ب)  عمل کدام آنزیم مقدمتر است؟

13 - وظایف ژن ساختاری و بخش تنظیم کننده را در اپران لک بنویسید.

14 - چرا جهشهای افزایش یا کاهش یک نوکلئوتید معمولآ اثرات فنوتیپی شدید تری دارند؟

15 - چنانچه یک نوکلئوتیدG بعداز حرف چهارم به توالی زیر وارد شود چه تاثیری بر ترجمه خواهد داشت؟             G

AUG-UAC-UGU-ACA-UAA                                                                                         

16 - اثر جهش های نقطه ای بر محصول ژن چیست؟

17 - با قرار دادن کلمات مناسب جملات زیر را کامل کنید.

الف) در پروکاریوتها عمدتا تنظیم بیان زن در سطح-------------میباشد.

ب)  با روشن شدن اپران لک یک mRNA ---------ژنی ساخته میشود.

ج) در گلبولهای سفید شناسایی راه انداز ژنهای پادتن بکمک -------------صورت میگیرد.

د) در اپران لک پروتئین تنظیم کننده به توالی ------------ متصل میگردد.

ذ) جهشی که در ---------------- افراد رخ دهد ممکن است به زاده ها منتقل شود.

18 - با افزودن نوکلئوتیدC دربین حروف10و11 توضیح دهید در پروتئین حاصل از ترجمه  ژن زیر چه تغییری ایجاد خواهد شد؟

TTT-AGA-CCA-ACT-ACA-ACC-TAG                                                              

C

19 - کدامیک از جملات زیر درست و کدامیک نادرست است؟

الف) تنظیم بیان ژن در باکتریها عمدتا در سطح رونویسی صورت میگیرد.

ب) عوامل رونویسی (فعال کننده) به ژنهای ساختاری متصل میشوند.

ج) توالی اپراتور میتواند به پروتئین تنظیم کننده متصل شود.

د) تنظیم بیان ژن در سلولهای پوششی میتواند پس از ترجمه باشد.

ذ) در کپک نوروسپورا MRNA رونویسی شده چند ژنی است.

20 - موارد زیر را مطالعه کرده سپس بنویسید در کدام قسمت از اپران لک جهش صورت گرفته است؟

الف) در محیط فاقد لاکتوز نیز اپران لک روشن است.

ب) پروتئین مهار کننده به آلو لاکتوز متصل نمیشود.

ج) آنزیمRNA پلیمراز نمیتواند اپران طبیعی را شناسایی و رونویسی کند.

21 - نقش عوامل رونویسی و افزاینده را در تنظیم بیان ژنهای یوکاریوتی شرح دهید.

22 - با اینکه ماده ژنتیک سلولهای عصبی و ماهیچه ای یکسان است چرا شکل وکار این سلولها متفاوت است؟

23 - تفاوت MRNA چند ژنی و MRNAتک ژنی چیست؟

24 - چگونه جهش جانشینی میتواند در بیان ژن تاثیر نداشته باشد. مثال بزنید؟



: | | غیــــــاثــــی: مدرس کنکور کشور | [ ]